pcmvha e2f2 plasmid Search Results


93
Addgene inc e2f2
a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, <t>E2F2</t> or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.
E2f2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmvha+e2f2+plasmid/pCMVHA+E2F2+(Plasmid+%2324226)/pmc12527934-282-7-19
Average 93 stars, based on 1 article reviews
e2f2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Journal: Nature

Article Title: Targeting G1–S-checkpoint-compromised cancers with cyclin A/B RxL inhibitors

doi: 10.1038/s41586-025-09433-w

Figure Lengend Snippet: a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Article Snippet: To make the DOX-on pTripz neo E2F1, E2F2 or E2F3 construct, pDONR223 E2F1 (W. G. Kaelin’s laboratory), pCMVHA E2F2 (Addgene, 24226) and pCMV Tag2B E2F3 (Addgene, 202522) were used as templates for overhang PCR to introduce the attB1 and attB2 sites onto the 5′ and 3′ ends of E2F1 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCCTTGGCCGGGGCCCCTGCG; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATCCAGGGGGGTGAGGTCCCC-3′), E2F2 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCAAGGGCCCCGGGCCTTG-3′; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCAACAGGTCCCCAAGGTC-3′) and E2F3 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAGAAAGGGAATCCAGCCCGCT; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTACTACACATGAAGTCTTCCACCAG-3′).

Techniques: Western Blot, Infection, Quantitation Assay, Concentration Assay, Expressing, Control